Cookies 🍪

We use cookies to ensure you the best possible experience when using BioLib. To read our privacy policy and configure what cookies are set, click on cookie settings below.


The library
of biological
data science


Access bioinformatics tools securely without leaving the browser. BioLib applications run on your local machine or using encrypted cloud computing.


Protein analyzer

Input datalock Encrypted

> Hemoglobin subunit theta

MALSAEDRALVRALWKKLGSNVGVYTTE

Result

floppy-disk
print

Stability (half-life)

  • ~ 30h reticulocytes, in vitro

  • > 20h yeast, in vitro

  • > 10h e. coli, in vitro

Molecular weight

15.507 kDa

Avg. hydropathicity

-2

+2

0.123

search-around Structure

BioLib

Open

Version

Developer

Profile Picture
star Favorite

Run from script

Correlation Matrix

This tool returns a correlation matrix and plot. The correlation between the data can be calculated by Pearson, Spearman or Kendall's method.

Examples

     A      B      C
A  1.000 -0.396  0.322
B -0.396  1.000  0.439
C  0.322  0.439  1.000

Generate insights

Access the latest data analysis tools

Generate insights from your data using bioinformatics tools on BioLib. You can run tools through the graphical user interface with just a few clicks or, if you are comfortable with programming, you can call them directly from existing notebooks or data pipelines.

modal
Run in the browser

Use BioLib applications without leaving your browser. No coding needed.

Try examplechevron-right
data-lineage
Integrate in existing data pipelines

Run BioLib applications directly from your notebooks or the terminal.

Read docschevron-right

Explore the library

Trending applications

Access a large and growing library of data analysis tools.

Stay in control of your data

All computation happens inside a secure sandbox. Your data never leaves your computer without your permission.

Read about data security on BioLibchevron-right

Built for bioinformagicians

Turn research into web servers

Build, design, and publish an application in minutes. Help other scientists get access to your work, increase citation count and make your research matter.

Start buildingchevron-right

BioLib

Create a new project

Editing – DNA analyzer

config.yml

1

2

3

4

5

6

7

8

9

10

11

12

13

14

arguments:

- key: '--sequence'

description:

'Input: Enter a DNA sequence'

type: text


- key: '--is_reversed'

description:

'Use the reverse complement?'

type: toggle

options:

'On': 'True'

'Off': 'False'

GUI

Input: Enter a DNA sequence

> Some DNA sequence

ATGGCCATCGCCATGGGAAGT

CCATGGGAAGTATGGCCATCG

AATGGCCATCGTGGCCATCGC

Use the reverse complement?

Run play

Focus on the data science

Build web tools without
HTML, CSS and JavaScript

You do not need to be a front-end developer or DevOps-wizard to make your tools accessible to a wide audience. Simply upload your source code, define the user inputs using a graphical interface or the YAML configuration file, and the application is ready to go!

database
No server maintenance

Host web tools without dealing with server configuration or maintenance.

Read docschevron-right
cloud-upload
Deploy across platforms

Publish an application on BioLib once and support all the major platforms.

View platformschevron-right

Access the library of biological data science